Review



phenol red free dmem f12 medium  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher phenol red free dmem f12 medium
    Phenol Red Free Dmem F12 Medium, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dmem+f12+medium/Phenol+Red/pm42274549-50-7-24
    Average 99 stars, based on 1 article reviews
    phenol red free dmem f12 medium - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Cell Culture:

    Article Title: U7 small nuclear RNA splice-switching therapeutics for STMN2 and UNC13A in Amyotrophic Lateral Sclerosis
    Article Snippet: .. 293T cells were cultured in DMEM/F12 medium (Gibco) with 10% tetracycline-free FBS and 1% Penicillin/Streptomycin. .. Inducible 293T TDP-43 knockdown cells were generated by transfecting 80% confluent cells in a well of a 6-well plate with AAVS1-SA-puro-EF1-hspCas9 (System Biosciences) targeting the AAVS1 locus (ggggccactagggacaggat) and pAAVS1-puro 2x TDP-43 shRNA in a 1:3 ratio.

    Article Title: TGFβ determines epithelial tissue spacing by regulating mesenchymal condensation
    Article Snippet: .. Briefly, tissue explants were cultured at the air-liquid interface on a porous membrane floating on DMEM/F12 medium (without HEPES; Gibco, 21041025) supplemented with 5% fetal bovine serum (FBS; R&D Systems, S11150H) and antibiotics (50 U/ml of penicillin and streptomycin; Thermo Fisher Scientific, 15070063). ..

    Article Title: Dysregulated RNA splicing impairs regeneration in alcohol-associated liver disease.
    Article Snippet: AML12 cells (ATCC, catalog number CRL-225) were seeded into 6-well plates (at a density of 2.0 × 105 cells per well). .. Sterile cover glasses were placed in the 24-well plates (at a density of 1.0 × 105 cells per well) and cultured in DMEM/F12 medium supplemented with insulin–transferrin–selenium (cat. no. 41400-045; Invitrogen) and 10% fetal bovine serum (heat-inactivated at 56 °C) at 37 °C in the presence of 95% air and 5% CO2. ..

    Article Title: U7 small nuclear RNA splice-switching therapeutics for STMN2 and UNC13A in Amyotrophic Lateral Sclerosis
    Article Snippet: This was then cloned into the pLVX-EF1a-mCherryT2A-BSD backbone digested with Cla1 (New England BioLabs) using InFusion Snap Assembly EcoDry (Takara Bio) following the manufacturer’s instructions. .. 21 μg of the cloned pLVX-EF1a-mCherryT2A-BSD-U7smOPT and 30 μl Trans-Lentiviral Packaging Mix (Dharmacon) was transfected using Lipofectamine 2000 (Invitrogen) following manufacturer’s instructions into >80% confluent HEK293T cells (Takara Bio) cultured in T-150 flasks using DMEM/F12 medium (Gibco) with 10% tetracycline-free FBS and 1% Penicillin/Streptomycin. .. Medium exchange was performed 24 hours post-transfection and 35ml supernatant was harvested, filtered with 0.45 μm SFCA filter (Thermo Scientific), and supplemented with LentiX Concentrator (1:4, Takara Bio) for the following two days.

    Article Title: Use of PAK4 and CRTC1 for treatment or diagnosis of brain degenerative disease
    Article Snippet: .. Cells were seeded on a culture plate coated with poly-D-lysine (Sigma) and laminin (Upstate Biotech, NY), and then cultured while replacing the medium with the chemically purified serum-free medium, DMEM/F12 medium (with 1% insulin-transferrin-selenium (ITS) supplement (Gibco), 100 U/ml of penicillin/streptomycin (Invitrogen) (DM)), for 2 days (DIV2), in order to suppress growth and proliferation of glial cells. ..

    Article Title: 3-n-Butylphthalide Protects SH-SY5Y Cells from Ferroptosis by Inhibiting ACSL4-Mediated Lipid Peroxidation.
    Article Snippet: Parkinson’s disease (PD) is the second most common neurodegenerative disorder, and its pathogenesis is closely associated with oxidative stress, mitochondrial dysfunction, and iron-dependent cell death.. In our previous study, we showed that 3-n-butylphthalide (NBP) alleviates behavioral deficits in a PD mouse model.. However, the underlying mechanisms remain unclear.

    Membrane:

    Article Title: TGFβ determines epithelial tissue spacing by regulating mesenchymal condensation
    Article Snippet: .. Briefly, tissue explants were cultured at the air-liquid interface on a porous membrane floating on DMEM/F12 medium (without HEPES; Gibco, 21041025) supplemented with 5% fetal bovine serum (FBS; R&D Systems, S11150H) and antibiotics (50 U/ml of penicillin and streptomycin; Thermo Fisher Scientific, 15070063). ..

    Knockdown:

    Article Title: U7 small nuclear RNA splice-switching therapeutics for STMN2 and UNC13A in Amyotrophic Lateral Sclerosis
    Article Snippet: Virus titre was estimated to be at least 1 x 10 IFU/ml using Lenti-X GoStix (Takara Bio) prior to freezing aliquots. .. ~2.5 million inducible TDP-43 knockdown SH-SY5Y cells in 5 ml DMEM/F12 medium (Gibco) supplemented with 10% tetracycline-free FBS, 1% Penicillin/Streptomycin and 4 μg/ml Polybrene (SantaCruz) in T-25 flasks were transduced with 100 μl of lentivirus for 24 hours. .. Stable clones were selected using 2 μg/ml Blasticidin (Gibco) for 4 days followed by 2 days 1 μg/ml Puromycin (Gibco) to reselect stable clones expressing the TDP-43 shRNA cassettes.

    Transduction:

    Article Title: U7 small nuclear RNA splice-switching therapeutics for STMN2 and UNC13A in Amyotrophic Lateral Sclerosis
    Article Snippet: Virus titre was estimated to be at least 1 x 10 IFU/ml using Lenti-X GoStix (Takara Bio) prior to freezing aliquots. .. ~2.5 million inducible TDP-43 knockdown SH-SY5Y cells in 5 ml DMEM/F12 medium (Gibco) supplemented with 10% tetracycline-free FBS, 1% Penicillin/Streptomycin and 4 μg/ml Polybrene (SantaCruz) in T-25 flasks were transduced with 100 μl of lentivirus for 24 hours. .. Stable clones were selected using 2 μg/ml Blasticidin (Gibco) for 4 days followed by 2 days 1 μg/ml Puromycin (Gibco) to reselect stable clones expressing the TDP-43 shRNA cassettes.

    Sterility:

    Article Title: Dysregulated RNA splicing impairs regeneration in alcohol-associated liver disease.
    Article Snippet: AML12 cells (ATCC, catalog number CRL-225) were seeded into 6-well plates (at a density of 2.0 × 105 cells per well). .. Sterile cover glasses were placed in the 24-well plates (at a density of 1.0 × 105 cells per well) and cultured in DMEM/F12 medium supplemented with insulin–transferrin–selenium (cat. no. 41400-045; Invitrogen) and 10% fetal bovine serum (heat-inactivated at 56 °C) at 37 °C in the presence of 95% air and 5% CO2. ..

    Article Title: AI-Accelerated Two-Photon FLIM Phasor Imaging for Label-Free Mapping of Macrophages in Influenza A Virus-Infected Human Lung Tissue
    Article Snippet: .. Lung lobes were filled with a mixture of phenol-red-free DMEM/F12 medium (Thermo Fisher Scientific) and 4% low-melting-point agarose (Thermo Fisher Scientific) under sterile conditions. .. Subsequently, precision-cut lung slices (PCLS) of 300 μm thickness were prepared from the agarose-filled lung lobes using a vibratome (Leica VT1200S, Leica, Illinois, USA).

    Clone Assay:

    Article Title: U7 small nuclear RNA splice-switching therapeutics for STMN2 and UNC13A in Amyotrophic Lateral Sclerosis
    Article Snippet: This was then cloned into the pLVX-EF1a-mCherryT2A-BSD backbone digested with Cla1 (New England BioLabs) using InFusion Snap Assembly EcoDry (Takara Bio) following the manufacturer’s instructions. .. 21 μg of the cloned pLVX-EF1a-mCherryT2A-BSD-U7smOPT and 30 μl Trans-Lentiviral Packaging Mix (Dharmacon) was transfected using Lipofectamine 2000 (Invitrogen) following manufacturer’s instructions into >80% confluent HEK293T cells (Takara Bio) cultured in T-150 flasks using DMEM/F12 medium (Gibco) with 10% tetracycline-free FBS and 1% Penicillin/Streptomycin. .. Medium exchange was performed 24 hours post-transfection and 35ml supernatant was harvested, filtered with 0.45 μm SFCA filter (Thermo Scientific), and supplemented with LentiX Concentrator (1:4, Takara Bio) for the following two days.

    Transfection:

    Article Title: U7 small nuclear RNA splice-switching therapeutics for STMN2 and UNC13A in Amyotrophic Lateral Sclerosis
    Article Snippet: This was then cloned into the pLVX-EF1a-mCherryT2A-BSD backbone digested with Cla1 (New England BioLabs) using InFusion Snap Assembly EcoDry (Takara Bio) following the manufacturer’s instructions. .. 21 μg of the cloned pLVX-EF1a-mCherryT2A-BSD-U7smOPT and 30 μl Trans-Lentiviral Packaging Mix (Dharmacon) was transfected using Lipofectamine 2000 (Invitrogen) following manufacturer’s instructions into >80% confluent HEK293T cells (Takara Bio) cultured in T-150 flasks using DMEM/F12 medium (Gibco) with 10% tetracycline-free FBS and 1% Penicillin/Streptomycin. .. Medium exchange was performed 24 hours post-transfection and 35ml supernatant was harvested, filtered with 0.45 μm SFCA filter (Thermo Scientific), and supplemented with LentiX Concentrator (1:4, Takara Bio) for the following two days.

    Purification:

    Article Title: Use of PAK4 and CRTC1 for treatment or diagnosis of brain degenerative disease
    Article Snippet: .. Cells were seeded on a culture plate coated with poly-D-lysine (Sigma) and laminin (Upstate Biotech, NY), and then cultured while replacing the medium with the chemically purified serum-free medium, DMEM/F12 medium (with 1% insulin-transferrin-selenium (ITS) supplement (Gibco), 100 U/ml of penicillin/streptomycin (Invitrogen) (DM)), for 2 days (DIV2), in order to suppress growth and proliferation of glial cells. ..

    Incubation:

    Article Title: 3-n-Butylphthalide Protects SH-SY5Y Cells from Ferroptosis by Inhibiting ACSL4-Mediated Lipid Peroxidation.
    Article Snippet: Parkinson’s disease (PD) is the second most common neurodegenerative disorder, and its pathogenesis is closely associated with oxidative stress, mitochondrial dysfunction, and iron-dependent cell death.. In our previous study, we showed that 3-n-butylphthalide (NBP) alleviates behavioral deficits in a PD mouse model.. However, the underlying mechanisms remain unclear.



    Similar Products

    99
    ATCC dmem f12
    Dmem F12, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dmem+f12+medium/DMEM%3A+F-12+Medium/pm42277434-325-5-6
    Average 99 stars, based on 1 article reviews
    dmem f12 - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher phenol red free dmem f12 medium
    Phenol Red Free Dmem F12 Medium, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dmem+f12+medium/Phenol+Red/pm42274549-50-7-24
    Average 99 stars, based on 1 article reviews
    phenol red free dmem f12 medium - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    86
    Procell Inc dmem f12 complete medium
    Dmem F12 Complete Medium, supplied by Procell Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dmem+f12+medium/dmem+medium/pm42319784-71-18-29
    Average 86 stars, based on 1 article reviews
    dmem f12 complete medium - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Procell Inc dmem f12 medium
    Dmem F12 Medium, supplied by Procell Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dmem+f12+medium/dmem+medium/pm42316290-77-6-11
    Average 86 stars, based on 1 article reviews
    dmem f12 medium - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Biosera Ltd low glucose dmem f12 medium
    Low Glucose Dmem F12 Medium, supplied by Biosera Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dmem+f12+medium/dmem+glucose+high/pm42235912-73-16-20
    Average 86 stars, based on 1 article reviews
    low glucose dmem f12 medium - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    Image Search Results